View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_high_72 (Length: 285)
Name: NF1519_high_72
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_high_72 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 13 - 139
Target Start/End: Original strand, 26494259 - 26494385
Alignment:
| Q |
13 |
catcaataactcctaattagtctacctttgtgatatcatcatcattatgatcataacacagctatttagcaacaaagagtactactcaatattttattct |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26494259 |
catctataactcctaattagtctacctttgtgatatcatcatcattatgatcataacacagctatttagcaacaaagagtactactcaatattttattct |
26494358 |
T |
|
| Q |
113 |
tgttgatcttctattcttcttcttcaa |
139 |
Q |
| |
|
|||||| |||||||||||||||||||| |
|
|
| T |
26494359 |
tgttgagcttctattcttcttcttcaa |
26494385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 199 - 262
Target Start/End: Original strand, 26494433 - 26494496
Alignment:
| Q |
199 |
ttctgtgcccattcctggttgtcagtccttgtatgagaagctagcatttgcactgatccacaaa |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26494433 |
ttctgtgcccattcctggttgtcagtccttgtatgagaagctagcatttgcactgatccacaaa |
26494496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University