View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_high_79 (Length: 268)
Name: NF1519_high_79
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_high_79 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 13 - 255
Target Start/End: Original strand, 39289785 - 39290027
Alignment:
| Q |
13 |
aatatgtacctatctactttctcctcattttccgctaaagaatgtcccattgaatgtgacctcgggaaaggatacttgtacaaaattctcaattcccgtg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39289785 |
aatatgtacctatctactttctcctcattttccgctaaaaaatgtcccgttgaatgtgacctcgggaaaggatacttgtccaaaattctcaattcccgtg |
39289884 |
T |
|
| Q |
113 |
aatggaaaatctcttcatcaacaatgttgctctcttcttgttgttgctcagttgattccgttgcggcgtcgatagggattgcaacgtcggggacatcagg |
212 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
39289885 |
aatggaaaatctcttcatcaacagtgttgctctcttcttgttgttgctccgttgattccgtcgcggcatcgatagggattgcagcgtcggggacatcagg |
39289984 |
T |
|
| Q |
213 |
ggtgagtttcgaacgacatacaggacaattcatatgagataat |
255 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39289985 |
ggtgagtttggaacgacatacaggacaattcatatgagataat |
39290027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 137 - 255
Target Start/End: Original strand, 39296946 - 39297064
Alignment:
| Q |
137 |
tgttgctctcttcttgttgttgctcagttgattccgttgcggcgtcgatagggattgcaacgtcggggacatcaggggtgagtttcgaacgacatacagg |
236 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||||| |||||| ||||| ||||| ||||| || ||||||||||| |
|
|
| T |
39296946 |
tgttgctctcttcttgttgttgctccgttgattccgtcgcggcatcgatagggattgcaatgtcgggaacatcgggggtaagtttggagcgacatacagg |
39297045 |
T |
|
| Q |
237 |
acaattcatatgagataat |
255 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
39297046 |
acaattcatatgagataat |
39297064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 25 - 132
Target Start/End: Original strand, 39296804 - 39296911
Alignment:
| Q |
25 |
tctactttctcctcattttccgctaaagaatgtcccattgaatgtgacctcgggaaaggatacttgtacaaaattctcaattcccgtgaatggaaaatct |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||||| |||||| |||||| ||| ||||||||||||||| || ||||||| | |
|
|
| T |
39296804 |
tctactttctcctcattttccgctaaagaatgacccgttgaatgtgacctcggtaaaggaaacttgtccaacattctcaattcccgtaaacggaaaatgt |
39296903 |
T |
|
| Q |
125 |
cttcatca |
132 |
Q |
| |
|
|||||||| |
|
|
| T |
39296904 |
cttcatca |
39296911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University