View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_low_103 (Length: 245)
Name: NF1519_low_103
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_low_103 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 15 - 211
Target Start/End: Complemental strand, 36445410 - 36445214
Alignment:
| Q |
15 |
gactgagtaaaagggacggcaatatatggtagaaagtcaaacataaaacgtccaaatttgtgagccaatctcgctcgcggtgcacatgctttttaaggtg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36445410 |
gactgagtaaaagggacggcaatatatggtagaaagtcaaacataaaacgtccaaatttgtgagccaatctcgctcgcggtgcacatgctttttaaggtg |
36445311 |
T |
 |
| Q |
115 |
gagaattttgatcaagatacattttcagtttcaattaatttatttttaactatccccatcccatgagtaggggtgggaatgagccggaccgtgccgg |
211 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
36445310 |
gagaattttgatcaagatacattttctgtatcaattaacttatttttaactatccccatcccatgagtaggggtgggaatgagttgggccgtgccgg |
36445214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University