View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_low_110 (Length: 238)
Name: NF1519_low_110
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_low_110 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 18 - 150
Target Start/End: Complemental strand, 42446358 - 42446226
Alignment:
| Q |
18 |
agtgttcccccacgagcagcctataatacacagtggactctcactctaattcaattcagctctcgtgcaaagcatttctctcgcgcaacgcatttctctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42446358 |
agtgttcccccacgagcagcctataatacacagtggactctcactctaattcaattcagctctcgtgcaaagcatttctctcgcgcaacgcatttctctc |
42446259 |
T |
 |
| Q |
118 |
gctacaaatgtaacaacctcattcattttcttc |
150 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
42446258 |
gctacaaatgtaacagcctcattcattttcttc |
42446226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 181 - 238
Target Start/End: Complemental strand, 42446186 - 42446129
Alignment:
| Q |
181 |
aatactaacaaggaataaatttataagaaaatactaacaaatgctctaaaaaatcttt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42446186 |
aatactaacaaggaataaatttataagaaaatactaacaagtgctctaaaaaatcttt |
42446129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University