View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_low_122 (Length: 216)
Name: NF1519_low_122
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_low_122 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 3019017 - 3019226
Alignment:
| Q |
1 |
agagtacttgagcaaatttatccaccatttctctttggtgcttgtctttgcaaagcttaacctccatgtgtgatactcaatgaatgataataata----- |
95 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3019017 |
agagtacttgagcaaagttatccaccatttctctttggtgcttgtctttgcaaatcttaacctccatgtgtgatactcaatgaatgataataataataat |
3019116 |
T |
 |
| Q |
96 |
-------ttacagttacattacatatagtagtactatgagtgaggattggagaagagtacgggacacgcacatgaaagaatccttatcatcatgtatgat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3019117 |
aatattattacagttacattacatatagtagtactatgagtgaggattggagaagagtacgggacacgcacatgaaaggatccttatcatcatgtatgat |
3019216 |
T |
 |
| Q |
189 |
gaacaaagat |
198 |
Q |
| |
|
|||||||||| |
|
|
| T |
3019217 |
gaacaaagat |
3019226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University