View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_low_127 (Length: 202)
Name: NF1519_low_127
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_low_127 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 13 - 185
Target Start/End: Original strand, 29688048 - 29688220
Alignment:
| Q |
13 |
cacagacaaataccctttactactgttattgattccaatttagaagcaaagtatttctatggttttgggtatgatgagtctactgatgattacctggttc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29688048 |
cacagacaaataccctttactactgttattgattccaatttagaagcaaagtatttctatggttttgggtatgatgagtctactgatgattacctggttc |
29688147 |
T |
|
| Q |
113 |
tttcaatgtgctatgatccaagtgcacgtggtttgttatctcacttggggcttttctcattaagagctaatac |
185 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29688148 |
tttcaatgtgctatgatccgagtgcacgtggtttgttatctcacttggggcttttctcattaagagctaatac |
29688220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 40 - 128
Target Start/End: Original strand, 29696173 - 29696261
Alignment:
| Q |
40 |
attgattccaatttagaagcaaagtatttctatggttttgggtatgatgagtctactgatgattacctggttctttcaatgtgctatga |
128 |
Q |
| |
|
|||||||||||| ||| ||||| ||||||||||||||||||||||| ||||| || ||||||||| |||| ||||||||| |||||| |
|
|
| T |
29696173 |
attgattccaatccagatgcaaattatttctatggttttgggtatgacgagtcaacagatgattacttggtgatttcaatgtcctatga |
29696261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 180
Target Start/End: Complemental strand, 29712582 - 29712440
Alignment:
| Q |
38 |
ttattgattccaatttagaagcaaagtatttctatggttttgggtatgatgagtctactgatgattacctggttctttcaatgtgctatgatccaagtgc |
137 |
Q |
| |
|
||||||||| ||||||||| ||| | |||| ||||||||||||||||| ||||| | ||||||||| | || ||||| |||| |||||||| | ||| |
|
|
| T |
29712582 |
ttattgattgcaatttagatgcatatcatttatatggttttgggtatgacgagtcaagggatgattacttcgtgctttccatgtcatatgatcccaatgc |
29712483 |
T |
|
| Q |
138 |
acgtggtttgttatctcacttggggcttttctcattaagagct |
180 |
Q |
| |
|
|| | |||| ||| ||| |||||||||||||| |||||| |
|
|
| T |
29712482 |
ttatgataagttaactcgcttagggcttttctcattgagagct |
29712440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 64 - 105
Target Start/End: Original strand, 179025 - 179066
Alignment:
| Q |
64 |
tatttctatggttttgggtatgatgagtctactgatgattac |
105 |
Q |
| |
|
||||||||||||||||||||||| ||||| || ||||||||| |
|
|
| T |
179025 |
tatttctatggttttgggtatgaggagtcaacagatgattac |
179066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University