View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_low_40 (Length: 379)
Name: NF1519_low_40
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_low_40 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 3e-95; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 3e-95
Query Start/End: Original strand, 161 - 361
Target Start/End: Complemental strand, 7161431 - 7161231
Alignment:
| Q |
161 |
ttgcaatataatatcaacaattttgccctagctagacagaatacttaagatttatttattttccttcggcttgctaaattatcatccctattttcctacg |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
7161431 |
ttgcaatataatatcaacaattttgccctagctagatagaatgcttaagatttatttattttcctacgacttgctaaattatcatccctattttcctacg |
7161332 |
T |
|
| Q |
261 |
acttgcaatataatagttttagacgctttatttcgatgaatatttttagatctatgattgaaaatgacggtgaccgggtgaaatgatgatattagatttt |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7161331 |
acttgcaatataatagttttagacgctttatttcgatgaatttttttagatctatgattgaaaatgacgatgaccgggtgaaatgatgatattagatttt |
7161232 |
T |
|
| Q |
361 |
a |
361 |
Q |
| |
|
| |
|
|
| T |
7161231 |
a |
7161231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 18 - 173
Target Start/End: Complemental strand, 7161602 - 7161448
Alignment:
| Q |
18 |
attgtatgtgaggttatcgacacaagtcgtgtgtttgtgggcaaaagagagtcgtgccatacagcacatctctaatggtgttatttttgtagctaatacc |
117 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||| ||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |||| | ||| |
|
|
| T |
7161602 |
attgtatgtgaggttatctatacaagtcgtgtgttcgtgggcaaa-gagagtcgtgccatatagcacatctctaatggtgttatttttgcagcttaaacc |
7161504 |
T |
|
| Q |
118 |
agaaccatgttcacacgacaacaatagttttagatgctggggtttgcaatataata |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7161503 |
agaaccatgttcacacgacaacaatagttttagatgctggggtttgcaatataata |
7161448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University