View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_low_54 (Length: 336)
Name: NF1519_low_54
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_low_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 310; Significance: 1e-175; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 310; E-Value: 1e-175
Query Start/End: Original strand, 15 - 328
Target Start/End: Original strand, 53820285 - 53820598
Alignment:
| Q |
15 |
cttctccacactcccaccttttctaaccattttcacccatgaaaatctcttcgaagcaaatgacattgctaccccgttgaaaaatgcaacggatacagaa |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53820285 |
cttcttcacactcccaccttttctaaccattttcacccatgaaaatctcttcgaagcaaatgacattgctaccccgttgaaaaatgcaacggatacagaa |
53820384 |
T |
|
| Q |
115 |
accgttaaactcataacatcttcaatcacacgtccaagttcaacactatctgaaactgacaacaacgttggtgaagatgaataaacaggaacatgcaatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53820385 |
accgttaaactcataacatcttcaatcacacgtccaagttcaacactatctgaaactgacaacaacgttggtgaagatgaataaacaggaacatgcaatt |
53820484 |
T |
|
| Q |
215 |
gttgttgttgtgtgacattcagattcacacaacggattccagaaactagtttctcaatttccttactcaacttcttcttagcttttaaatatataactaa |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53820485 |
gttgttgttgtgtgacattcagattcacacaacggattccagaaactagtttctcaatttccttactcaacttcttcttagcttttaaatatataactaa |
53820584 |
T |
|
| Q |
315 |
ctttgattcatctc |
328 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
53820585 |
ctttgattcatctc |
53820598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University