View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_low_80 (Length: 274)
Name: NF1519_low_80
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_low_80 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 7e-55; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 5116170 - 5116054
Alignment:
| Q |
1 |
agaaagtaaacccctctcggtcaaactgatcgacttgatgaatgttggatttacccacttcttccttaagcacgtccatgcaatgtttagtgaatggatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
5116170 |
agaaagtaaacccctctcggtcaaactgatcgacttgatgaatgttggatttacccacttcttccttaagcgcgtgcatgcaatgtttagtgaatggatc |
5116071 |
T |
|
| Q |
101 |
acaagagcctaccatta |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
5116070 |
acaagagcctaccatta |
5116054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 201 - 259
Target Start/End: Complemental strand, 5115771 - 5115713
Alignment:
| Q |
201 |
caagaacattatatcccaccattgacagtggctagttatcactcttcaattttgaaagt |
259 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5115771 |
caagaacattgtatcccaccattgacagtggctagttatcactcttcaattttgaaagt |
5115713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 118 - 155
Target Start/End: Complemental strand, 5115850 - 5115813
Alignment:
| Q |
118 |
taatttaatgcctgctgatttgcctctcgagctatcat |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5115850 |
taatttaatgcctgctgatttgcctctcgagcaatcat |
5115813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University