View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_low_82 (Length: 268)
Name: NF1519_low_82
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_low_82 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 16 - 262
Target Start/End: Complemental strand, 53425793 - 53425547
Alignment:
| Q |
16 |
cagttggaaaggcacatgcatggcctcaaaagatttcaattcatccaactgtaacaggtgtgttgtgaataagatgtttttcatcgatctgaattgatta |
115 |
Q |
| |
|
|||||||||||||| |||||| | |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53425793 |
cagttggaaaggcatctgcatgacatcaaaagacttcaactcatccaactgtaacaggtgtgttgtgaataagatgtttttcatcgatctgaattgatta |
53425694 |
T |
|
| Q |
116 |
tgattttgtaacaaaatattacataaatttaaccaaaccctgctaatcaatatgtgattgatttgaatttctctctcacataaatcgagtcaagccaacc |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53425693 |
tgattttgtaacaaaatattaaataaatttaaccaaaccctgctaatcaatatgtgattgatttgaatttctctctcacataaatcgagtcaagccaacc |
53425594 |
T |
|
| Q |
216 |
tgttatatcctatacattatttctatgtttacgctgatgatgtccat |
262 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||| |||||| |
|
|
| T |
53425593 |
tgttatatcccatacattatttctatgtttacgcttatgaggtccat |
53425547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 18 - 74
Target Start/End: Complemental strand, 53434081 - 53434025
Alignment:
| Q |
18 |
gttggaaaggcacatgcatggcctcaaaagatttcaattcatccaactgtaacaggt |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
53434081 |
gttggaaaggcacatgcatggcctcaaaagatttcaactcatccaactgtaacaggt |
53434025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 74
Target Start/End: Complemental strand, 26098791 - 26098735
Alignment:
| Q |
18 |
gttggaaaggcacatgcatggcctcaaaagatttcaattcatccaactgtaacaggt |
74 |
Q |
| |
|
||||||| || || |||||| | |||||||||||||| ||||||||||||||||||| |
|
|
| T |
26098791 |
gttggaatggtacctgcatgacatcaaaagatttcaactcatccaactgtaacaggt |
26098735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University