View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_low_84 (Length: 267)
Name: NF1519_low_84
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_low_84 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 38816651 - 38816407
Alignment:
| Q |
1 |
tagttatattcgtgaatcgtgatagtgttggagactgacatctgttggacactggacacacctttaatatgaagtctcggtgctagatatttatgggaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38816651 |
tagttatattcgtgaatcgtgatagtgttggagactgacatctgttggacactgcacacacctttaatatgaagtctcggtgctagatatttatgggaga |
38816552 |
T |
|
| Q |
101 |
tatttatttgtgaagtttctttctaaggctttcttgttgtgtgttcaggtgaagatttgagtgatcttgctgtggaacattcaatttgcccttctaaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38816551 |
tatttatttgtgaagtttctttctaaggctttcttgttgtgtgttcaggtgaagatttgagtgatcttgctgtggaacattcaatttgcccttctaaaga |
38816452 |
T |
|
| Q |
201 |
tgaaggaggaatgcttgggtgggtgagaaagggacaaatggtatg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38816451 |
tgaaggaggaatgcttgggtgggtgagaaagggacaaatggtatg |
38816407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 135 - 246
Target Start/End: Complemental strand, 38821928 - 38821817
Alignment:
| Q |
135 |
tgttgtgtgttcaggtgaagatttgagtgatcttgctgtggaacattcaatttgcccttctaaagatgaaggaggaatgcttgggtgggtgagaaaggga |
234 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||| |||| | ||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
38821928 |
tgttgtgtgtccaggtgaagatttgagcgatcttgctgtggactattcggtgtgcccatctaaagaagaaggaggaaggcttgggtgggtgagaaaggga |
38821829 |
T |
|
| Q |
235 |
caaatggtatga |
246 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38821828 |
caaatggtatga |
38821817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 64
Target Start/End: Complemental strand, 35665597 - 35665559
Alignment:
| Q |
26 |
tgttggagactgacatctgttggacactggacacacctt |
64 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
35665597 |
tgttggaaactgacatgtgttggacactggacacacctt |
35665559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University