View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_low_88 (Length: 262)
Name: NF1519_low_88
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_low_88 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 2231988 - 2231768
Alignment:
| Q |
17 |
aaattggagtcttgattcaagtaaatgatacatttgtaagtggtgtctatcatatgttgtttaccgtagagcagatagattgatctgacacctatgatat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||| |||||||||||||||||| |
|
|
| T |
2231988 |
aaattggagtcttgattcaagtaaatgatacatttgtaagtgatgtctatcatatgttgtttattgtcgagcagatagattaatctgacacctatgatat |
2231889 |
T |
|
| Q |
117 |
tttttgagataaagttctctctttaaaggtttctttatttgtttggcattgttacgccatcagatacattcgaaggataatttaattcaacttaaaatta |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2231888 |
tttttgagataaagttctctctttgaagatttctttatttgtttggcattgttacaccatcagatacattcgaaggataatttaattcgacttaaaatta |
2231789 |
T |
|
| Q |
217 |
tactgcctaaatctaatatgt |
237 |
Q |
| |
|
|||| |||||||||||||||| |
|
|
| T |
2231788 |
tactacctaaatctaatatgt |
2231768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University