View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_low_90 (Length: 258)
Name: NF1519_low_90
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_low_90 |
 |  |
|
| [»] chr5 (10 HSPs) |
 |  |
|
| [»] scaffold0188 (1 HSPs) |
 |  |  |
|
| [»] scaffold0425 (1 HSPs) |
 |  |  |
|
| [»] scaffold0674 (1 HSPs) |
 |  |  |
|
| [»] scaffold0549 (1 HSPs) |
 |  |  |
|
| [»] scaffold0045 (1 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0206 (1 HSPs) |
 |  |  |
|
| [»] scaffold0190 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 10)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 50 - 258
Target Start/End: Complemental strand, 39062677 - 39062470
Alignment:
| Q |
50 |
aaagaaatattatctcccctacaaatcctctagtttggcggagagctaaatttatctttgaagaaattttgatcactttcccttttgataagtaaatcaa |
149 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39062677 |
aaagaaatattatctcccctacagatcctctagtttggcggagagctaaatttatctttgaagaaattttgatcactttcccttttgataagtaaatcaa |
39062578 |
T |
 |
| Q |
150 |
acaccttaaatttaggtcatcttatttgacggatataattgtcatattatatagttcctcttgttacaaaacataagtttgcatgagaaggaaattaatt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39062577 |
acaccttaaatttaggtcatcttatttgacggatataattgtcatattatatagttcctc-tgttacgaaacataagtttgcatgagaaggaaattaatt |
39062479 |
T |
 |
| Q |
250 |
aattattca |
258 |
Q |
| |
|
||||||||| |
|
|
| T |
39062478 |
aattattca |
39062470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 19647725 - 19647675
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggacccaa |
51 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
19647725 |
tttatggtatgcttaacccgtgccccgggggcaccggttagccggacccaa |
19647675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 8787477 - 8787525
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
8787477 |
tttatggtatgcttaacctgtgccccgggggcaccggttagcaggaccc |
8787525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 13661946 - 13661994
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
13661946 |
tttatggtatgcttaacccgtgccccggaggcaccggttagcaggaccc |
13661994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 34650881 - 34650833
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
34650881 |
tttatggtatgcttaaccagtgccccgggggcaccggttagcaggaccc |
34650833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 10054401 - 10054352
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
||||||||||| |||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
10054401 |
tttatggtatgtttaacccgtgccccgggggtaccggttagcaggaccca |
10054352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 35132659 - 35132707
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
35132659 |
tttatggtatgcttaaccaatgccccgggggcaccggttagcaggaccc |
35132707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 35504288 - 35504241
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
35504288 |
tttatggtatgcttaacccgtgtc-cgggggcaccggttagcaggaccc |
35504241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 11958015 - 11957967
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||| |||||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
11958015 |
tttatggcatgcttaaccagtgccccaggggcaccggttagcaggaccc |
11957967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 21547442 - 21547393
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
|||||||||||||||||| || || ||| | ||||||||||||||||||| |
|
|
| T |
21547442 |
tttatggtatgcttaaccagtaccccggagacaccggttagcaggaccca |
21547393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 17)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 10617332 - 10617281
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggacccaaa |
52 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10617332 |
tttatggtatgcttaacccgtgccccgggggcaccggttagcaggacccaaa |
10617281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 46352772 - 46352821
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
46352772 |
tttatggtatgcttaacccgtgccccggaggcaccggttagcaggaccca |
46352821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 858727 - 858775
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
858727 |
tttatggtatgcttaacccgtgccccgggggcaccggttagccggaccc |
858775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 4168321 - 4168369
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
4168321 |
tttatggtatgcttaacccgtaccccgggggcaccggttagcaggaccc |
4168369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 43787009 - 43787057
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
43787009 |
tttatggtatgcttaaccagtgccccgggggcaccggttagcaggaccc |
43787057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 52520819 - 52520867
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
52520819 |
tttatggtatgcttaaccagtgccccgggggcaccggttagcaggaccc |
52520867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 272358 - 272407
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||||||||||||||||||| |
|
|
| T |
272358 |
tttatggtatgcttaatcggtgccccgggggcaccggttagcaggaccca |
272407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 6842757 - 6842806
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||| |
|
|
| T |
6842757 |
tttatggtatgcttaaccagtgccccgggggcagcggttagcaggaccca |
6842806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 39074556 - 39074604
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
39074556 |
tttatggtatgcttaaccagtgccccaggggcaccggttagcaggaccc |
39074604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 43269787 - 43269739
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| ||| |||||||||||||||||||| |
|
|
| T |
43269787 |
tttatggtatgcttaaccagtgccccggaggcaccggttagcaggaccc |
43269739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 49893469 - 49893518
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||||||||||| ||||||| |
|
|
| T |
49893469 |
tttatggtatgcttaatcagtgccccgggggcaccggttagccggaccca |
49893518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 40362628 - 40362580
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||||| |||| |||||||||||| |
|
|
| T |
40362628 |
tttatggtatgcttaaccagtgccccgggggtaccgattagcaggaccc |
40362580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 8 - 49
Target Start/End: Original strand, 53163911 - 53163952
Alignment:
| Q |
8 |
tatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||| ||||| ||| |||||||||||||||||||| |
|
|
| T |
53163911 |
tatgcttaacctgtgccccggaggcaccggttagcaggaccc |
53163952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 2938088 - 2938040
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||||||||| || || || ||||||||||||||||||||| |
|
|
| T |
2938088 |
tttatggtatgcttaacgagtaccccgagggcaccggttagcaggaccc |
2938040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 11308259 - 11308211
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| |||| | ||||||||| |||||||||||| |
|
|
| T |
11308259 |
tttatggtatgcttaaccaatgccccaggggcaccgattagcaggaccc |
11308211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 18014810 - 18014858
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||| | ||||| |||||||||| ||||||| ||||| |
|
|
| T |
18014810 |
tttatggtatgcttaatcagtgccccgggggcaccagttagcaagaccc |
18014858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 48725409 - 48725457
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||| ||| |||||||||||||| |
|
|
| T |
48725409 |
tttatggtatgcttaaccagtgccccgggaccacgggttagcaggaccc |
48725457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 4e-16; HSPs: 20)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 34228820 - 34228871
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggacccaaa |
52 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
34228820 |
tttatggtatgcttaaccagtgccccgggggcaccggttagcaggacccaaa |
34228871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 16394109 - 16394059
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggacccaa |
51 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
16394109 |
tttatggtatgcttaaccaatgccccgggggcaccggttagcaggacccaa |
16394059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 168604 - 168652
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
168604 |
tttatggtatgcttaaccaatgccccgggggcaccggttagcaggaccc |
168652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 7 - 51
Target Start/End: Original strand, 9934557 - 9934601
Alignment:
| Q |
7 |
gtatgcttaacccgtgccacgggggcaccggttagcaggacccaa |
51 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9934557 |
gtatgtttaacccgtgccccgggggcaccggttagcaggacccaa |
9934601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 10618136 - 10618184
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||||||| | | |||||||||||||||||||||| |
|
|
| T |
10618136 |
tttatggtatgcttaacccgtgtctccggggcaccggttagcaggaccc |
10618184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 27988547 - 27988500
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
27988547 |
tttatggtatgcttaaccagtgcc-cgggggcaccggttagcaggaccc |
27988500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 28045849 - 28045802
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
28045849 |
tttatggtatgcttaaccagtgcc-cgggggcaccggttagcaggaccc |
28045802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 7304566 - 7304511
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggacccaaagaaa |
56 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
7304566 |
tttatggtatgcttaaccagtgctccgggggcaccggttagtaggacccatagaaa |
7304511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 30675621 - 30675574
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggacc |
48 |
Q |
| |
|
|||||||||||||||||| ||||| ||||| ||||||||||||||||| |
|
|
| T |
30675621 |
tttatggtatgcttaaccagtgccccggggacaccggttagcaggacc |
30675574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 7 - 49
Target Start/End: Complemental strand, 2490199 - 2490157
Alignment:
| Q |
7 |
gtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
2490199 |
gtatgcttaacccgtgcctcgggggcaccggttagcatgaccc |
2490157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 16890528 - 16890482
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggac |
47 |
Q |
| |
|
|||||||||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
16890528 |
tttatggtatgcttaaccggtgcctccggggcaccggttagcaggac |
16890482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 5 - 50
Target Start/End: Complemental strand, 16888588 - 16888543
Alignment:
| Q |
5 |
tggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
16888588 |
tggtatgcttaaccaatgccccgggggcaccggttagcaggaccca |
16888543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 51
Target Start/End: Complemental strand, 43723772 - 43723731
Alignment:
| Q |
10 |
tgcttaacccgtgccacgggggcaccggttagcaggacccaa |
51 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
43723772 |
tgcttaacccgtgccccgggggcaccggttagcagcacccaa |
43723731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 2805308 - 2805260
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| ||| ||||||||||||| |||||| |
|
|
| T |
2805308 |
tttatggtatgcttaaccagtgccccggaggcaccggttagccggaccc |
2805260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 4537792 - 4537744
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| | | |||||||||||||||||||| |
|
|
| T |
4537792 |
tttatggtatgcttaacctgtgccccagaggcaccggttagcaggaccc |
4537744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 11112777 - 11112825
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||| |
|
|
| T |
11112777 |
tttatggtatgcttaacctgtgccctgggggcactggttagcaggaccc |
11112825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 49
Target Start/End: Original strand, 18955840 - 18955882
Alignment:
| Q |
7 |
gtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||| ||||| |
|
|
| T |
18955840 |
gtatgcttaacccatgccccgggggcaccggttagcatgaccc |
18955882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 9537872 - 9537823
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
|||||||||||||||||| ||| | ||| | ||||||||||||||||||| |
|
|
| T |
9537872 |
tttatggtatgcttaaccagtgtcccggagacaccggttagcaggaccca |
9537823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 13643149 - 13643197
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| || ||||||||||||||||||| |
|
|
| T |
13643149 |
tttatggtatgcttaaccagtgccctaggagcaccggttagcaggaccc |
13643197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 13743574 - 13743622
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| || ||||||||||||||||||| |
|
|
| T |
13743574 |
tttatggtatgcttaaccagtgccctaggagcaccggttagcaggaccc |
13743622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 22)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 38162988 - 38163035
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggacc |
48 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38162988 |
tttatggtatgcttaacccgtgccccgggggcaccggttagcaggacc |
38163035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 18043300 - 18043348
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
18043300 |
tttatggtatgcttaaccagtgccccgggggcaccggttagcaggaccc |
18043348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 29210532 - 29210580
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
29210532 |
tttatggtatgcttaaccagtgccccgggggcaccggttagcaggaccc |
29210580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 24178511 - 24178460
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggacccaaa |
52 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||| ||||||||| |
|
|
| T |
24178511 |
tttatggtatgcttaaccagtgccccgggggcaccggttagccggacccaaa |
24178460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 3784761 - 3784713
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||| |||||| |
|
|
| T |
3784761 |
tttatggtatgcttaacccgtgtcccgggggcaccggttagccggaccc |
3784713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 5694459 - 5694507
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
5694459 |
tttatggtatgcttaaccagtgctccgggggcaccggttagcaggaccc |
5694507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 12072110 - 12072062
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||| |||| |
|
|
| T |
12072110 |
tttatggtatgcttaaccagtgccccgggggcaccggttagcagcaccc |
12072062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 29657909 - 29657957
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
29657909 |
tttatggtatgcttaaccagtgccctgggggcaccggttagcaggaccc |
29657957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 42770038 - 42769990
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||| |||| |
|
|
| T |
42770038 |
tttatggtatgcttaaccagtgccccgggggcaccggttagcagaaccc |
42769990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 51065796 - 51065748
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
51065796 |
tttatggtatgcttaaccagtgccccaggggcaccggttagcaggaccc |
51065748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 2 - 49
Target Start/End: Complemental strand, 38701984 - 38701937
Alignment:
| Q |
2 |
ttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||||||||| ||||| || ||||||||||||||||||||| |
|
|
| T |
38701984 |
ttatggtatgcttaaccagtgccccgagggcaccggttagcaggaccc |
38701937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 30294429 - 30294380
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
|||||||||||||||||| |||| ||||| ||||||||||||||||||| |
|
|
| T |
30294429 |
tttatggtatgcttaacctgtgctccggggacaccggttagcaggaccca |
30294380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 15227877 - 15227925
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| ||| |||||||||||||| ||||| |
|
|
| T |
15227877 |
tttatggtatgcttaaccagtgccccggaggcaccggttagcaagaccc |
15227925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 21112729 - 21112681
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||||||||| ||||| || ||||||||||||||||||||| |
|
|
| T |
21112729 |
tttatggtatgcttaactagtgccccgagggcaccggttagcaggaccc |
21112681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 21117471 - 21117423
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||||||||| ||||| || ||||||||||||||||||||| |
|
|
| T |
21117471 |
tttatggtatgcttaacttgtgccccgagggcaccggttagcaggaccc |
21117423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 47010131 - 47010179
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| |||| | |||||||||||||||||||||| |
|
|
| T |
47010131 |
tttatggtatgcttaaccagtgctccaggggcaccggttagcaggaccc |
47010179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 48383159 - 48383103
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggacccaaagaaat |
57 |
Q |
| |
|
|||||||||||||||||| |||| | ||||||| ||||||||||||||||| |||| |
|
|
| T |
48383159 |
tttatggtatgcttaaccaatgcctcaggggcactggttagcaggacccaaaaaaat |
48383103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 4 - 49
Target Start/End: Complemental strand, 14350323 - 14350279
Alignment:
| Q |
4 |
atggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||||||| ||||| ||||| |||||||||||||||||| |
|
|
| T |
14350323 |
atggtatgcttaaccagtgccccgggg-caccggttagcaggaccc |
14350279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 23822565 - 23822520
Alignment:
| Q |
7 |
gtatgcttaacccgtgccacgggggcaccggttagcaggacccaaa |
52 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| |||||||| |
|
|
| T |
23822565 |
gtatgcttaaccaatgccccgggggcaccggttagcatgacccaaa |
23822520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 30657740 - 30657789
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
|||||||||||||||||| || || ||| ||||||| ||||||||||||| |
|
|
| T |
30657740 |
tttatggtatgcttaaccagtaccccggaggcaccgattagcaggaccca |
30657789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 19031863 - 19031815
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||| |||||||||||||| || ||| | |||||||||||||||||| |
|
|
| T |
19031863 |
tttatgatatgcttaacccgtaccccggagacaccggttagcaggaccc |
19031815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 45449292 - 45449244
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||| |||||| ||||| | |||||| ||||||||||||||| |
|
|
| T |
45449292 |
tttatggtatgtttaaccagtgccccaggggcatcggttagcaggaccc |
45449244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 17)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 30486348 - 30486398
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggacccaa |
51 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
30486348 |
tttatggtatgcttaaccagtgccccgggggcaccggttagcaggacccaa |
30486398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 20553069 - 20553117
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
20553069 |
tttatggtatgcttaaccagtgccccgggggcaccggttagcaggaccc |
20553117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 32360917 - 32360867
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggacccaa |
51 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
32360917 |
tttatggtatgcttaaccaatgccccgggggcaccggttagcaggacccaa |
32360867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 31390150 - 31390199
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
31390150 |
tttatggtatgcttaacccgtgctccgggggcaccgattagcaggaccca |
31390199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 22068368 - 22068320
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||| |||||||||||| |
|
|
| T |
22068368 |
tttatggtatgcttaaccagtgccccgggggcaccgattagcaggaccc |
22068320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 22567740 - 22567788
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
22567740 |
tttatggtatgcttaacccgtgctccaggggcaccggttagcaggaccc |
22567788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 27856444 - 27856396
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
27856444 |
tttatggtatgcttaaccagtgccccgggggcatcggttagcaggaccc |
27856396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 31438784 - 31438832
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| ||||| |||||||||||||||||| |
|
|
| T |
31438784 |
tttatggtatgcttaaccagtgccccggggacaccggttagcaggaccc |
31438832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 50
Target Start/End: Complemental strand, 31782607 - 31782564
Alignment:
| Q |
7 |
gtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
31782607 |
gtatgcttaacccgtgcctcgggggcaccggttagcatgaccca |
31782564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 4381933 - 4381981
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||| |||| |||||||||||||| |
|
|
| T |
4381933 |
tttatggtatgcttaaccagtgccccgggagcactggttagcaggaccc |
4381981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 26387112 - 26387064
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||| |||||||| |
|
|
| T |
26387112 |
tttatggtatgcttaaccagtgccttgggggcaccggttaacaggaccc |
26387064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 34442580 - 34442533
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
34442580 |
tttatggtatgcttaaccagtgcc-cgggggcatcggttagcaggaccc |
34442533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 44588040 - 44588088
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||||||||| ||||| |||||| ||||||||||||||||| |
|
|
| T |
44588040 |
tttatggtatgcttaacaagtgccccgggggtaccggttagcaggaccc |
44588088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 12 - 49
Target Start/End: Complemental strand, 19037002 - 19036965
Alignment:
| Q |
12 |
cttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
19037002 |
cttaacccgtgccccgggggcaccggttagcagcaccc |
19036965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 22887888 - 22887937
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||| |||||| |
|
|
| T |
22887888 |
tttatggtatgcttaaccagtgctccgggggcaccgattagcatgaccca |
22887937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 35851799 - 35851750
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacggggg-caccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| |||| |||||| |||||||||||||||||| |
|
|
| T |
35851799 |
tttatggtatgcttaaccaatgcctcggggggcaccggttagcaggaccc |
35851750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 28601104 - 28601152
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| |||| ||| ||||||||||||||||||| |
|
|
| T |
28601104 |
tttatggtatgcttaaccagtgcactgggagcaccggttagcaggaccc |
28601152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 8)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 24438615 - 24438664
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
24438615 |
tttatggtatgcttaaccagtgccccgggggcaccggttagcaggaccca |
24438664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 34333421 - 34333469
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34333421 |
tttatggtatgtttaacccgtgccccgggggcaccggttagcaggaccc |
34333469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 34606399 - 34606447
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
34606399 |
tttatggtatgcttaacccgtgccccgggagcaccggttagcaggaccc |
34606447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 4628704 - 4628755
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggacccaaa |
52 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
4628704 |
tttatggtatgcttaaccagtgccttaggggcaccggttagcaggacccaaa |
4628755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 24798451 - 24798400
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggacccaaa |
52 |
Q |
| |
|
||||| |||||||||||| ||||| |||||||||| |||||||||||||||| |
|
|
| T |
24798451 |
tttatagtatgcttaaccagtgccccgggggcaccagttagcaggacccaaa |
24798400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 5239423 - 5239472
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
||||||||||||||||| ||||| | ||||||| ||||||||||||||| |
|
|
| T |
5239423 |
tttatggtatgcttaacttgtgcccccggggcactggttagcaggaccca |
5239472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 29993535 - 29993486
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
|||||||||||||||||| ||| | ||| |||| |||||||||||||||| |
|
|
| T |
29993535 |
tttatggtatgcttaaccagtgtcccggaggcatcggttagcaggaccca |
29993486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 18486099 - 18486143
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcagg |
45 |
Q |
| |
|
|||||||||||||||||||||||| || | |||||||||||||| |
|
|
| T |
18486099 |
tttatggtatgcttaacccgtgccccgaagacaccggttagcagg |
18486143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0188 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0188
Description:
Target: scaffold0188; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 6158 - 6110
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6158 |
tttatggtatgtttaacccgtgccccgggggcaccggttagcaggaccc |
6110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 14)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 392234 - 392282
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
392234 |
tttatggtatgcttaaccagtgccccgggggcaccggttagcaggaccc |
392282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 23402276 - 23402324
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
23402276 |
tttatggtatgcttaacccgtgccccggaggcaccggttagcaggaccc |
23402324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 32929556 - 32929508
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
32929556 |
tttatggtatgcttaaccagtgccccgggggcaccggttagcaggaccc |
32929508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 4215833 - 4215881
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
4215833 |
tttatggtatgcttaaccagtgccccgggggcatcggttagcaggaccc |
4215881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 32985241 - 32985193
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||| |||| |
|
|
| T |
32985241 |
tttatggtatgcttaaccagtgccccgggggcaccggttagcagaaccc |
32985193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 34477617 - 34477569
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||| || ||||||||||||||||| |
|
|
| T |
34477617 |
tttatggtatgcttaacccgtgccccggaggtaccggttagcaggaccc |
34477569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 3515904 - 3515953
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
||||||||||| |||||| ||||| | ||||||||||||||||||||||| |
|
|
| T |
3515904 |
tttatggtatgtttaacctgtgccccaggggcaccggttagcaggaccca |
3515953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 27433630 - 27433678
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||| ||||||||| || |||||||||||||||||| ||||| |
|
|
| T |
27433630 |
tttatggtatgtttaacccgttccccgggggcaccggttagcaagaccc |
27433678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 49
Target Start/End: Original strand, 34706865 - 34706907
Alignment:
| Q |
7 |
gtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
34706865 |
gtatgcttaaccagtgccccgggggcaccggttagcaagaccc |
34706907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 50
Target Start/End: Complemental strand, 12145165 - 12145116
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
||||| |||||||||||| |||| ||| ||||||||||||||||||||| |
|
|
| T |
12145165 |
tttatagtatgcttaaccagtgctccggaggcaccggttagcaggaccca |
12145116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 8 - 49
Target Start/End: Complemental strand, 18276653 - 18276612
Alignment:
| Q |
8 |
tatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
18276653 |
tatgcttaaccagtgcccctggggcaccggttagcaggaccc |
18276612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 20898067 - 20898115
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
|||||||||||||||||| ||||| | ||||||||||||||| ||||||| |
|
|
| T |
20898067 |
tttatggtatgcttaacctgtgcc-ccggggcaccggttagccggaccca |
20898115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 35044027 - 35044086
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggacccaaagaaatattat |
62 |
Q |
| |
|
|||||||||||||||||| ||||| | ||||||||||||| || |||||||| ||||||||| |
|
|
| T |
35044027 |
tttatggtatgcttaaccagtgcc-ccggggcaccggttaacatgacccaaa-aaatattat |
35044086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 2581090 - 2581138
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| | || |||| ||||||||||||||||||| |
|
|
| T |
2581090 |
tttatggtatgcttaaccaataccccgggagcaccggttagcaggaccc |
2581138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 17)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 16820990 - 16821038
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
16820990 |
tttatggtatgcttaaccagtgccccgggggcaccggttagcaggaccc |
16821038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 33108721 - 33108673
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
33108721 |
tttatggtatgcttaacccgtgccccggaggcaccggttagcaggaccc |
33108673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 4268870 - 4268809
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggacccaaagaaatattat |
62 |
Q |
| |
|
||||||||||| |||||| ||||| || |||||||||||||||||||||| | ||||||||| |
|
|
| T |
4268870 |
tttatggtatgattaaccagtgccccgagggcaccggttagcaggacccataaaaatattat |
4268809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 7769076 - 7769124
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||| || ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7769076 |
tttatggcatacttaacccgtgccccgggggcaccggttagcaggaccc |
7769124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 16536186 - 16536234
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||| ||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
16536186 |
tttatggtattcttaaccagtgccccgggggcaccggttagcaggaccc |
16536234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 29591327 - 29591375
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
29591327 |
tttatggtatgcttaactagtgccccgggggcaccggttagcaggaccc |
29591375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 54054667 - 54054715
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||| ||||||||| |
|
|
| T |
54054667 |
tttatggtatgcttaaccagtgccccgggggcaccggttggcaggaccc |
54054715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 55882820 - 55882868
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
55882820 |
tttatggtatacttaacccgtgcctcgggggcaccggttagtaggaccc |
55882868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 12356382 - 12356431
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
12356382 |
tttatggtatgcttaaccagtgttccgggggcaccggttagcaggaccca |
12356431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 18067927 - 18067879
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||| ||||||||| || |||||||||||||||||| ||||| |
|
|
| T |
18067927 |
tttatggtatgtttaacccgttccccgggggcaccggttagcaagaccc |
18067879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 32217182 - 32217230
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| ||| ||||||||||| |||||||| |
|
|
| T |
32217182 |
tttatggtatgcttaacctgtgccccggaggcaccggttaacaggaccc |
32217230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 36395237 - 36395285
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| ||||||||||||| |
|
|
| T |
36395237 |
tttatggtatgcttaaccagtgccctgggggcaccagttagcaggaccc |
36395285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 43202431 - 43202384
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||| |||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
43202431 |
tttatggtaagcttaaccagtgcc-cgggggcaccggttagcaggaccc |
43202384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 6164231 - 6164280
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
|||||||||||||||||| || || || || ||||||||||||||||||| |
|
|
| T |
6164231 |
tttatggtatgcttaaccagtaccccgaggacaccggttagcaggaccca |
6164280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 54897446 - 54897495
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
||||||||||| |||||| ||| | ||| ||||||||||||||||||||| |
|
|
| T |
54897446 |
tttatggtatgtttaaccagtgtcccggaggcaccggttagcaggaccca |
54897495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 4089280 - 4089328
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||| |||||| ||||| | |||||||| ||||||||||||| |
|
|
| T |
4089280 |
tttatggtatgtttaaccagtgccccaggggcaccagttagcaggaccc |
4089328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 50619224 - 50619271
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| | ||||||||||||||| |||||| |
|
|
| T |
50619224 |
tttatggtatgcttaaccagtgcc-caggggcaccggttagcgggaccc |
50619271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0425 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0425
Description:
Target: scaffold0425; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 10848 - 10897
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||||||||||||| |
|
|
| T |
10848 |
tttatggtatgcttaaccagtgcctcgggggcagcggttagcaggaccca |
10897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0674 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0674
Description:
Target: scaffold0674; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 7964 - 7916
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||| || ||||||||||||||||| |
|
|
| T |
7964 |
tttatggtatgcttaacccgtgccccggaggtaccggttagcaggaccc |
7916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0549 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0549
Description:
Target: scaffold0549; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 7407 - 7455
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||||||||| ||| || ||||||||||||||||| |
|
|
| T |
7407 |
tttatggtatgcttaacccgtgccccggaggtaccggttagcaggaccc |
7455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 53405 - 53344
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggacccaaagaaatattat |
62 |
Q |
| |
|
||||||||||||||||| ||||| ||| ||||||||||||||||||| ||| |||| |||| |
|
|
| T |
53405 |
tttatggtatgcttaactagtgccccggaggcaccggttagcaggaccgaaacaaattttat |
53344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 69363 - 69411
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
|||||||||||||||||| ||||| |||| ||||||||||| ||||||| |
|
|
| T |
69363 |
tttatggtatgcttaaccagtgcctcgggagcaccggttagaaggaccc |
69411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 53733 - 53685
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||| ||||||||| || |||||||||||||||||| ||||| |
|
|
| T |
53733 |
tttatggtatgtttaacccgttccccgggggcaccggttagcaagaccc |
53685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0206 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0206
Description:
Target: scaffold0206; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 11037 - 10987
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggacccaaa |
52 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| |||||||||||||||| |
|
|
| T |
11037 |
tttatggtatgcttaactggtgcc-cgggggcaccagttagcaggacccaaa |
10987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0190 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0190
Description:
Target: scaffold0190; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 15034 - 15083
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccca |
50 |
Q |
| |
|
|||||||||||||||||| ||||| ||| ||||| ||||| ||||||||| |
|
|
| T |
15034 |
tttatggtatgcttaaccagtgccccggaggcactggttaacaggaccca |
15083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 233991 - 234039
Alignment:
| Q |
1 |
tttatggtatgcttaacccgtgccacgggggcaccggttagcaggaccc |
49 |
Q |
| |
|
||||||||||| |||||| || | |||||||||||||||||||||||| |
|
|
| T |
233991 |
tttatggtatgtttaaccggtactccgggggcaccggttagcaggaccc |
234039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University