View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_low_93 (Length: 250)
Name: NF1519_low_93
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_low_93 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 11 - 250
Target Start/End: Complemental strand, 32147068 - 32146826
Alignment:
| Q |
11 |
cacagaccagaccaaccacaatacacacccttaggatacctcaaatttacacaagtaatgctacaatttcgatcgtcatttggacatggca---ctttgc |
107 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32147068 |
cacagaccagaccaaccgcaatacacacccttaggatacctcaaatttacacaagtgatactacaatttcgatcgtcatttggacatggcagcactttgc |
32146969 |
T |
|
| Q |
108 |
actaatactttttgtgcagaaatgtctggttcaaaacaattgataagattttataacttggaaccaaggatggtgataccttggttttaaccttgcctaa |
207 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32146968 |
actaatactttttgtgaagaaatgtctggttcaaaacaattgatgagattttataacttggaaccaaggttggtgataccttggttttaaccttgcctaa |
32146869 |
T |
|
| Q |
208 |
tactttttcatgtacttgatgttctcttctttgatcttgatgt |
250 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
32146868 |
tactttttcatgtacttgatgttctgttatttgatcttgatgt |
32146826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 161 - 249
Target Start/End: Complemental strand, 32155879 - 32155786
Alignment:
| Q |
161 |
taacttggaaccaaggatggtgataccttggttttaa-ccttgcctaatact----ttttcatgtacttgatgttctcttctttgatcttgatg |
249 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||| |||||||||||||| ||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
32155879 |
taacttggaaccaaagttggtgataccttggtttttttccttgcctaatactcactttttcatgtacttgatgttctgctctttgaccttgatg |
32155786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 36 - 106
Target Start/End: Complemental strand, 42255712 - 42255643
Alignment:
| Q |
36 |
cacccttaggatacctcaaatttacacaagtaatgctacaatttcgatcgtcatttggacatggcactttg |
106 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||| |||||| || | |||||||||||||||||| ||||| |
|
|
| T |
42255712 |
cacccttaagatacctcaaatttatgcaagtaacactacaactt-gctcgtcatttggacatggccctttg |
42255643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University