View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_low_95 (Length: 250)
Name: NF1519_low_95
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_low_95 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 20 - 232
Target Start/End: Original strand, 25002767 - 25002979
Alignment:
| Q |
20 |
aagaaaatcaaagccagcaggaaactgcaaaatcaaatcaacttattagatctctctcaactctcaccaacttcttctccctcttctccaccacaacaga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25002767 |
aagaaaatcaaagccagcaggaaactgcaaaatcaaatcaacttattagatctctctcaactctcaccaacttcttctccctcttctccaccacaacaga |
25002866 |
T |
 |
| Q |
120 |
atttggataacgttgttccatgcttcaatccaaccattaaccgccctcgatgcctcgctagaaagaaactctttgctgttgcaccagtttttactgaaca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |||||| |||| |||||||||||||| |
|
|
| T |
25002867 |
atttggataacgttgttccatgcttcaacccaaccattaaccgccctcgatgcctcgctagaaagaaacttttcgctgttacacctgtttttactgaaca |
25002966 |
T |
 |
| Q |
220 |
cacagacacatat |
232 |
Q |
| |
|
||||||||||||| |
|
|
| T |
25002967 |
cacagacacatat |
25002979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 20 - 228
Target Start/End: Complemental strand, 24998791 - 24998580
Alignment:
| Q |
20 |
aagaaaatcaaagccagcaggaaactgcaaaatcaaatcaacttattagatctctct-caactctcaccaacttcttctccctc---ttctccaccacaa |
115 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||||| ||||| |||| |||||| ||| |||| || ||||||| ||| | |
|
|
| T |
24998791 |
aagaaaatcaaagccaacaggaagctgcaaaatcaaatcaacttattagaactctcaacaacaa-caccaatttcacctccttccttttctccatcacca |
24998693 |
T |
 |
| Q |
116 |
cagaatttggataacgttgttccatgcttcaatccaaccattaaccgccctcgatgcctcgctagaaagaaactctttgctgttgcaccagtttttactg |
215 |
Q |
| |
|
|||||||||||||| || || || |||||| |||| ||| ||||||||||||| ||||| ||||| ||||||||||| || ||| |||| |||||||||| |
|
|
| T |
24998692 |
cagaatttggataatgtcgtaccttgcttcgatcccacctttaaccgccctcgctgccttgctaggaagaaactcttcgcggttacacccgtttttactg |
24998593 |
T |
 |
| Q |
216 |
aacacacagacac |
228 |
Q |
| |
|
||||||||||||| |
|
|
| T |
24998592 |
aacacacagacac |
24998580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University