View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1519_low_97 (Length: 249)
Name: NF1519_low_97
Description: NF1519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1519_low_97 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 5 - 158
Target Start/End: Complemental strand, 6857997 - 6857832
Alignment:
| Q |
5 |
tgtcgaagaatattatttgtccacgtttctagtctttgcttttaagtgaggttgtatgcaccctgttttttgagatgaggctcgcgtgtaccttttagat |
104 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6857997 |
tgtcgaaaaatattgtttgtccacgtttctagtctttgcttttaagtgaggttgtatgcaccctattttttgagatgaggctcgcgtgtaccttttagat |
6857898 |
T |
|
| Q |
105 |
ttttgaa------------tgaatgtttataatgttataaaaatatctctccaacaaaaattataa |
158 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6857897 |
ttttgaatgaacttttgaatgaatgtttataatattataaaaatatctctccaacaaaaattataa |
6857832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University