View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15200_high_2 (Length: 321)
Name: NF15200_high_2
Description: NF15200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15200_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 1 - 311
Target Start/End: Original strand, 52475820 - 52476124
Alignment:
| Q |
1 |
aaggtttctgaagcagatgatgataaacccttctcaataaggtaccataccatttcctacatgctttaaaattaatgttactataaatatgtatagactt |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52475820 |
aagggttctgaagcagatgatgataaacccttctcaataaggtacc-----atttcctacatgctttaaaattaatgttactataaatatgtatagactt |
52475914 |
T |
 |
| Q |
101 |
atgttttcaaaaacaaggttttgttgttattttattttcactttcaaattatatatgtcattattgcatgttctatatttggatattatctcttgattta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52475915 |
atgttttcaaaaacaaggttttgttgttattttattttcactttcaaattatatatgtcattattgcatgttctatatttggata-tatctcttgattta |
52476013 |
T |
 |
| Q |
201 |
atgtccctcgcacttctaagatatttagcacatgttcgttgtgccttatttacaatttttgaacgcaactgaagctgattaggattattattttttgttc |
300 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52476014 |
atgtctatcgcacttctaaggtatttagcacatgttcgttgtgccttatttacaatttttgaacgcaactgaaactgattaggattattattttttgttc |
52476113 |
T |
 |
| Q |
301 |
aattccctttg |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
52476114 |
aattccctttg |
52476124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University