View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15201_low_5 (Length: 286)
Name: NF15201_low_5
Description: NF15201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15201_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 18 - 132
Target Start/End: Complemental strand, 34429259 - 34429145
Alignment:
| Q |
18 |
gagggtttcgatagagtgagaagatgaagttgaaggagcgtcagacgttcgttgtcggatgttgaaaggaagtgaggggatggaagggaaggggaaagat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34429259 |
gagggtttcgatagagtgagaagatgaagttgaaggagcgtcagacgttcgttgtcggatgttgaaaggaagtgaggggatggaagggaaggggaaagat |
34429160 |
T |
|
| Q |
118 |
tcttgttcgggaaga |
132 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34429159 |
tcttgttcgggaaga |
34429145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 131
Target Start/End: Original strand, 33738416 - 33738529
Alignment:
| Q |
18 |
gagggtttcgatagagtgagaagatgaagttgaaggagcgtcagacgttcgttgtcggatgttgaaaggaagtgaggggatggaagggaaggggaaagat |
117 |
Q |
| |
|
|||||||| ||| ||||||||||| ||||||||||||| | |||| |||||||||||||| |||||||| | || |||||||| |||| ||||||||| |
|
|
| T |
33738416 |
gagggttttgattgagtgagaagacgaagttgaaggagtgccagaggttcgttgtcggattttgaaagggaaggatgggatggatgggagagggaaagat |
33738515 |
T |
|
| Q |
118 |
tcttgttcgggaag |
131 |
Q |
| |
|
| ||||| |||||| |
|
|
| T |
33738516 |
tgttgtttgggaag |
33738529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University