View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15202_low_3 (Length: 284)
Name: NF15202_low_3
Description: NF15202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15202_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 37 - 268
Target Start/End: Original strand, 55015178 - 55015405
Alignment:
| Q |
37 |
ctttcttgaatttaacaagaatagagtgagtgtgtcattgtggttgtttgttaattgtcttcaagttagccacgaagctttttgttttgattgtgcgtta |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55015178 |
ctttcttgaatttaacaagaatagagtgagtgtgtcattgtggttgtttgttaattgtcttcaagttagccacgaagctttttgttttgattgtgcgtta |
55015277 |
T |
|
| Q |
137 |
tactaacttctttttaacttattggcgtgaagttcttatattagtttgattgatcaaccttagtggagtctccccttacgaatggttaatactcaaataa |
236 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
55015278 |
tactaacttctttttaacttattggtgtgaagttcttatattagtttgattgatcaaccttagtggagtctccccttacaaatggttaatactc----aa |
55015373 |
T |
|
| Q |
237 |
ataaataaacattaactaagacttgagattta |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
55015374 |
ataaataaacattaactaagacttgagattta |
55015405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University