View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15204_high_25 (Length: 264)
Name: NF15204_high_25
Description: NF15204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15204_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 29 - 241
Target Start/End: Complemental strand, 47056039 - 47055827
Alignment:
| Q |
29 |
ctataattttgactagttttttatgatgcaatctcaattgccatcattgttcatgtcagctcagcatgcaaagcattaccattgccaattttgattacaa |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47056039 |
ctataattttgactagttttttatgatgcaatctcaattgccatcattgttcatgtcagctcagcatgcaaagcattgccattgccaattttgattacaa |
47055940 |
T |
 |
| Q |
129 |
gtataaatattttctatgagatttgtgcaatattgccgcaatccataatgaccgaaatcgtgatgaaatccttaacgcgcctcgaccgatatttaaacgt |
228 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47055939 |
gtataaatatttttgatgagatttgtgcaatattgccgatatccataatgaccaaaatcgtgatgaaatccttaacgcgcctcgaccgatatttaaacgt |
47055840 |
T |
 |
| Q |
229 |
tgcaaaaaattct |
241 |
Q |
| |
|
|||||||||||| |
|
|
| T |
47055839 |
cgcaaaaaattct |
47055827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 7 - 36
Target Start/End: Original strand, 47056064 - 47056093
Alignment:
| Q |
7 |
gttcttgcttttaagaatccttctataatt |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47056064 |
gttcttgcttttaagaatccttctataatt |
47056093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University