View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15204_high_26 (Length: 256)
Name: NF15204_high_26
Description: NF15204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15204_high_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 31557305 - 31557549
Alignment:
| Q |
1 |
tccaagaatataatcttctagatttgtcacaattgatactctcaaatattcaaacggagttgtttccactttgcaactcaaaaaggactctacttcatca |
100 |
Q |
| |
|
||||| ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31557305 |
tccaaaaatataatcttttaggtttgtcacaattgatactctcaaatattcaaacggagttgtttccactttgcaactcaaaaaggactctacttcatca |
31557404 |
T |
|
| Q |
101 |
aaccgagaattattgacattaattccaactagcatgcttttataaaaattcacatttaatctagatacaatatcatagagcatagaagtttttatcgatc |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31557405 |
aagcgagaattattgacattaattccaactagcatgcttttataaaaattcacatttaatctagatacaatatcatatagcatagaagtttttatcgatc |
31557504 |
T |
|
| Q |
201 |
aaatattggaccaagacttatctcatattatcaaagtatcatcat |
245 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31557505 |
aaatgttggatcaagacttatctcatattatcaaagtatcatcat |
31557549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University