View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15204_high_30 (Length: 238)
Name: NF15204_high_30
Description: NF15204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15204_high_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 18 - 185
Target Start/End: Complemental strand, 4779927 - 4779759
Alignment:
| Q |
18 |
gatatctattgcaaaaacagtcctaaaattgtgacgtagnnnnnnn-gagcaatcttggtatttggctgatgatgtatcgtttttgcaacttgccacatt |
116 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4779927 |
gatatttattgcaaaaacagtcctaacattgtgacgtagttttttttgagcaatcttggtatttggctgatgatgtatcgtttttgcaacttgccacatt |
4779828 |
T |
|
| Q |
117 |
tacgctgcaaatatctgtgtaaggggaaaaaacaacgtgctcaatcctaatttacatggtgattgtgag |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4779827 |
tacgctgcaaatatctgtgtaaggggaaaaaacaacgtgctcaatcctaatttacatggtgattgtgag |
4779759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 177 - 238
Target Start/End: Complemental strand, 4779587 - 4779526
Alignment:
| Q |
177 |
gattgtgagagtaacaaaaacagatttctttttaccaaaataaattcatgtcatttcacttt |
238 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4779587 |
gattgtgagagtaacaaaaacaggtttctttttaccaaaataaattcatgtcatttcacttt |
4779526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University