View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15204_high_6 (Length: 573)
Name: NF15204_high_6
Description: NF15204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15204_high_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 4e-67; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 413 - 566
Target Start/End: Complemental strand, 31557697 - 31557544
Alignment:
| Q |
413 |
ggggtgtggtctttgacaaaggttcatctccttttctatttttgatagcaatcgaaaggtcgaattctatgctaaatgagtctattttgaaaaatttctt |
512 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
31557697 |
ggggtgtggtctttgacaaaggttcgtttccttttctatttttgatagcaatggaatggtcgaattctatgctaaatgagtctattttgaaaaatttgtt |
31557598 |
T |
|
| Q |
513 |
ttatgggttcaaggtgggttgggaggagaatctcttatttttagtttgatgatg |
566 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31557597 |
ttatgggttcaaggtgggctgggaggagaatctcttatttttagtttgatgatg |
31557544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 238 - 330
Target Start/End: Complemental strand, 31558381 - 31558290
Alignment:
| Q |
238 |
atatatttattttgttagggaaataagacgaatgtacttttatcaatatattatagactttcccaaaactatcagtaattcaactagaatact |
330 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31558381 |
atatatttaatttgttagggaaataagacgaatg-acttttatcaatatattatagactttcccaaaactatcagtaattcaactagaatact |
31558290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 380 - 415
Target Start/End: Complemental strand, 31558240 - 31558205
Alignment:
| Q |
380 |
acatcttatgatgaggagacattagaggaaaaaggg |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
31558240 |
acatcttatgatgaggagacattagaggaaaaaggg |
31558205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University