View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15204_low_29 (Length: 253)
Name: NF15204_low_29
Description: NF15204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15204_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 244
Target Start/End: Original strand, 40072821 - 40073047
Alignment:
| Q |
18 |
gttcttggttatcgaaacaaaagtagcagcagcatcagaagcactagattcctcgccggaataatcagagaatttatcttcatcttcttcaacctcaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40072821 |
gttcttggttatcgaaacaaaagtagcagcagcatcagaagcactagattcctcgccggaataatcagagaatttatcttcatcttcttcaacctcaaca |
40072920 |
T |
|
| Q |
118 |
gtcttactctttatgttgttgaattcaatcggcggcacaacgttgagaatctcagcaatagaacgcttcttcggtgctttaggtttagatttgaaaccag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40072921 |
gtcttactctttatgttgttgaattcaatcggcggcacaacgttgagaatctcagcaatagaacgcttcttcggcgctttaggtttagatttgaaaccag |
40073020 |
T |
|
| Q |
218 |
ccctcgccgactgacgccgttcatctc |
244 |
Q |
| |
|
|||||||| ||||||||||||||||| |
|
|
| T |
40073021 |
tcctcgccgtctgacgccgttcatctc |
40073047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University