View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15204_low_31 (Length: 238)
Name: NF15204_low_31
Description: NF15204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15204_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 222
Target Start/End: Complemental strand, 31048375 - 31048169
Alignment:
| Q |
16 |
cagttggatcgtcataatgcagtttggattgtgcattatattcagattttcttgtgcccatgtttgatagtggaacaatttctttggttgggataatttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31048375 |
cagttggatcgtcataatgcagtttggattgtgtattatattcagattttcttgtgcccatgtttgatagtggaacaatttctttggttgggataatttg |
31048276 |
T |
|
| Q |
116 |
tggggttttctcttactttgagagaatttttcacgttaaaattttggggtctcttgtgcgttttatttattctgtttgctaccataaaattgttgttact |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
31048275 |
tggggttttctcttactttgagagaatttttcccgttaaaattttggggtctcttgtgcgttttatttattctgtttgctaccataaaattgttgttgct |
31048176 |
T |
|
| Q |
216 |
cctcaca |
222 |
Q |
| |
|
||||||| |
|
|
| T |
31048175 |
cctcaca |
31048169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University