View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15204_low_35 (Length: 229)
Name: NF15204_low_35
Description: NF15204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15204_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 40865320 - 40865516
Alignment:
| Q |
18 |
taattatctacccagaattgtcttccattgctaatttgctaattacgtttcaacttggtgtagaaaatgaaatttctggggttgcctcaaacaataagta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40865320 |
taattatctacccagaattgtcttccattgctaatttgccaattacgtttcaacttggtgtagaaaatgaaatttctggggttgcctcaaacaataagta |
40865419 |
T |
 |
| Q |
118 |
ttgattactattggcacgctgggtccagactccataacccctaaatggcttccacgtcatagctgatgtcgttcaattcaagggatatatccttcat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40865420 |
ttgattactattggcacgctgggtccagactccataacccctaaatggcttccacgtcatagctgatgtgcttcaattcaagggatatatccttcat |
40865516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University