View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15204_low_35 (Length: 229)

Name: NF15204_low_35
Description: NF15204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15204_low_35
NF15204_low_35
[»] chr4 (1 HSPs)
chr4 (18-214)||(40865320-40865516)


Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 40865320 - 40865516
Alignment:
18 taattatctacccagaattgtcttccattgctaatttgctaattacgtttcaacttggtgtagaaaatgaaatttctggggttgcctcaaacaataagta 117  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40865320 taattatctacccagaattgtcttccattgctaatttgccaattacgtttcaacttggtgtagaaaatgaaatttctggggttgcctcaaacaataagta 40865419  T
118 ttgattactattggcacgctgggtccagactccataacccctaaatggcttccacgtcatagctgatgtcgttcaattcaagggatatatccttcat 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||    
40865420 ttgattactattggcacgctgggtccagactccataacccctaaatggcttccacgtcatagctgatgtgcttcaattcaagggatatatccttcat 40865516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University