View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15204_low_38 (Length: 206)
Name: NF15204_low_38
Description: NF15204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15204_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 33645321 - 33645461
Alignment:
| Q |
48 |
gaataaaaaaggttgttttgttattaggtaatgaaaaataacatttttaaacgttgtatgtctatgttgtgatcaaaacacaagttcgttgattaagtgt |
147 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33645321 |
gaataaaaaatgttgttttgttattaggtaatgaaaaataacttttttaaacgttgtatgtctatgttgtgatcaaaacacaagttcgttgattaactgt |
33645420 |
T |
 |
| Q |
148 |
aatacatggctccatgtattgactacaatagtggctccaag |
188 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33645421 |
aatatatggctccatgtattgactacaatagtggctccaag |
33645461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University