View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15204_low_5 (Length: 610)
Name: NF15204_low_5
Description: NF15204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15204_low_5 |
 | |
|
| [»] scaffold0251 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0251 (Bit Score: 347; Significance: 0; HSPs: 2)
Name: scaffold0251
Description:
Target: scaffold0251; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 94 - 566
Target Start/End: Complemental strand, 6929 - 6467
Alignment:
| Q |
94 |
atgagggtgttgtcaaacaggtggataacgagtatttcacgagcgtttggaacgatatttgggtggaagacacnnnnnnnnnnnnaggtcaaaggtttat |
193 |
Q |
| |
|
||||| |||||||||||| ||||| ||||| |||||||||||||| |||||||||||||||||||| ||| || ||||||||||||||| |
|
|
| T |
6929 |
atgagtgtgttgtcaaaccggtgggtaacgtgtatttcacgagcgcttggaacgatatttgggtggtagatactatcta------aggtcaaaggtttat |
6836 |
T |
|
| Q |
194 |
gggcttttgttggtctatgaacaaaaatactatggttgcgcaatgttgacattgtgagtcgaacaagtctgtgtgacagtttgttaggacgaagaagttg |
293 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6835 |
aggcttttgttggtctatgaacaaaaagactttggttgcgcaatgttgacattgtgagtcgaacaagtctgtgtgactgtttgttaggacgaagaagttg |
6736 |
T |
|
| Q |
294 |
tttgtgtgggagtaccagctattggaggagctaaagtcagttttatgcagggttaccatcaattctatttggcggttaaaagttggagttgctgggattg |
393 |
Q |
| |
|
|| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6735 |
ttcgtgtgggagtaccagttattggaggagctaaagtcagttttatgcagggttaccatcaattctatttggcggttaaaagttggagttgctgggattg |
6636 |
T |
|
| Q |
394 |
ttctaagtaggtgttgctctgttagtttagccaataattttgattcagtacatatatatgtttggactacaggaatccaagttgaggagactaatattct |
493 |
Q |
| |
|
|||||| | ||| ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6635 |
ttctaaattggttttgctctgttagtttagccaataattttgtttcagtac----atatgtttggactacaggaatccaagttgaggagactaatattct |
6540 |
T |
|
| Q |
494 |
agttgttcttcgaaaaaacttagctccctttaaggtgatcatgttctcttagcactttttaagagaacttatt |
566 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6539 |
agttgttcttcgaaaaaacttagctccctttaaggtgatcatgttctcttagcactttttaagagaacttatt |
6467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0251; HSP #2
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 560 - 592
Target Start/End: Complemental strand, 4583 - 4551
Alignment:
| Q |
560 |
acttattcatcattgttagacaggatgcctact |
592 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4583 |
acttattcatcattgttagacaggatgcctact |
4551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University