View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15205_high_27 (Length: 250)
Name: NF15205_high_27
Description: NF15205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15205_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 40641876 - 40642110
Alignment:
| Q |
1 |
agcactaaaattaaaatttagacaaggctttatactattttccaaaggcaacctagaattttagtgaaaatggatttttcttggtgttccctctggtttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40641876 |
agcactaaaattaaaatttagacaaggctttatactattttccaaaggcaacctagaattttagtgaagatggatttttcttggtgttccctctggtttg |
40641975 |
T |
 |
| Q |
101 |
atgtgaaaatctctttgaaacttacaatttgaagtaaatgctgaaaaatttgaatgctggtttatactgaaatggttgctctgtggtttgtttgattctg |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40641976 |
atgtgaaaatctctttcaaacttacaatttggagtaaatgccgaaaaatttgaatgctggtttatactgaaatggttactctgtggtttgtttgattctg |
40642075 |
T |
 |
| Q |
201 |
tacaaagagtagatatatgtgttctttgtgtttgt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40642076 |
tacaaagagtagatatatgtgttctttgtgtttgt |
40642110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University