View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15205_low_35 (Length: 250)
Name: NF15205_low_35
Description: NF15205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15205_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 26246895 - 26246662
Alignment:
| Q |
1 |
ccttgcattgtgacaccatcctctaatctcaaaatttcattataattgttttttatttaaatttgacaccttatttttaaaagagaacaaatgtgtatgt |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
26246895 |
ccttgcactgtgacaccatcctctaatctcaaaatttcattataatt-ttttttatttaaatttgacaccttatttttaaaagagaacaaatgtgtatat |
26246797 |
T |
 |
| Q |
101 |
ataaaaaatcgtgttctaactcatattgtgaagttacttnnnnnnnnnnnnnnctcatattgtgaactttgttgtatctctatattcaaaatacaatgag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26246796 |
ataaaaaatcgtgttctaactcatattgtgaagttactt-aaaaaaataaaaactcatattgtgaactttgttgcatctctatattcaaaatacaatgag |
26246698 |
T |
 |
| Q |
201 |
aatatgtctaatcaaaattcaaggaaaatcataatt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
26246697 |
aatatgtctaatcaaaattcaaggaaaatcataatt |
26246662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University