View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15205_low_42 (Length: 223)
Name: NF15205_low_42
Description: NF15205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15205_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 16 - 205
Target Start/End: Original strand, 10378294 - 10378483
Alignment:
| Q |
16 |
aatataaatgcaaccctaaaatgaagcatgaatagttaatgtatgttttagttaannnnnnnnnnnnngctgaatcaaaagcaaacaaaatcatgaggag |
115 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10378294 |
aatataaacgcaaccctaaaatgaagcatgaatagttaatgtatgttttagttaatttttttttttt-gctgaatcaaaagcaaacaaaatcatgaggag |
10378392 |
T |
|
| Q |
116 |
atagttttaaatcctaactaggttggcactcgacggctgccccatcctctaccaccttgctcatctct-aataaatgtggggagagagtac |
205 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
10378393 |
atagtttgaaatcctaactaggttggcactcgacggctgccccatcctctaccacgttgctcatctctaaataaatgtggggagagagtac |
10378483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University