View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15206_high_11 (Length: 281)
Name: NF15206_high_11
Description: NF15206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15206_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 99 - 263
Target Start/End: Original strand, 12033191 - 12033355
Alignment:
| Q |
99 |
cctgtgcaatataatgtaatttggaacaagatggtaccttaggttattttgaacaatttgattagacgtgaaattttaatgtggatgaccacctttatgt |
198 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12033191 |
cctgtgtaatataatgtaatttggaacaagatggtaccttaggttattttgaacaatttgattagacgtgaaattttaatgtggatgaccacctttatgt |
12033290 |
T |
 |
| Q |
199 |
agtgactagtgctttgataaatcatgatctagagaatgcatgctacacggtttgatagattgacc |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12033291 |
agtgactagtgctttgataaatcatgatctagagaatgcatgctacacggtttgatagattgacc |
12033355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University