View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15206_low_14 (Length: 260)
Name: NF15206_low_14
Description: NF15206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15206_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 11 - 241
Target Start/End: Original strand, 27309004 - 27309238
Alignment:
| Q |
11 |
aagaacccttaaatagcatagcatatatacaaaattggacccttacatc----cacacatggaatatattatatattttttgtctttgagtcatgtctat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27309004 |
aagaacccttaaatagcatagcatatatacaaaattggacccttacatccatccacacatggaatatattatatattttttgtctttgagtcatgtctat |
27309103 |
T |
|
| Q |
107 |
ccaatcnnnnnnnnatgactaggaatttaatttagtaatttagggtttacgatactcatactatcatgcacactgcacatcaaccacttcattagcagca |
206 |
Q |
| |
|
|||||| |||| ||||||||||||| | ||||||||||||||| ||||||||||| |||| ||||||||||||||||||||| ||||| |||| |
|
|
| T |
27309104 |
ccaatcttttttttatgattaggaatttaattcattaatttagggtttacaatactcatactgtcatacacactgcacatcaaccactttattagtagca |
27309203 |
T |
|
| Q |
207 |
gacgcaaccacttctataatatttcttcaacgttt |
241 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||| |
|
|
| T |
27309204 |
gacgcaaccactttcataatattcctttaacgttt |
27309238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University