View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15206_low_20 (Length: 238)
Name: NF15206_low_20
Description: NF15206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15206_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 11 - 69
Target Start/End: Original strand, 18601195 - 18601253
Alignment:
| Q |
11 |
gaccctcatgtccactatgcatattattttattttatacgaacaagtattatcatgtcc |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18601195 |
gaccctcatgtccactatgcatattattttattttatacgaacaagtattatcatgtcc |
18601253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 128 - 222
Target Start/End: Original strand, 18601310 - 18601404
Alignment:
| Q |
128 |
caacgtagctgttcttccttccttcttgacccagcccgcagctatggagtgtatacgcaagacnnnnnnngagctaatcgcaaatgacaaggcaa |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
18601310 |
caacgtagctgttcttccttccttcttgacccagcgcgccgctatggagtgtatacgcaagaatttttttgagctaatctcaaatgacaaggcaa |
18601404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University