View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15206_low_22 (Length: 237)
Name: NF15206_low_22
Description: NF15206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15206_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 35795837 - 35795621
Alignment:
| Q |
1 |
taggatccataatatttagacacttatcaatacttaattttatacttatgtttctaatttaatcaaatctattagatcgttaacatatcacatttattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35795837 |
taggatccataatatttagacacttatcaatacttaattttatacttatgtttctaatttaatcaaatctattagatcgttaacatatcacatttattat |
35795738 |
T |
|
| Q |
101 |
ataa-nnnnnnnnatctctttctctcttaaggtatatatacatgttgagatgtctattaaatattattcaaatgtcttttagtagataacgatgatcata |
199 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||| ||||||||||||| ||||||||||||||| |||||||||||||||| | |||||| |
|
|
| T |
35795737 |
ataatttttttttatctctt--tctcttaaggtatatatac---ttgagatgtctatcaaatattattcaaatttcttttagtagataaccgtaatcata |
35795643 |
T |
|
| Q |
200 |
tttttaatctacttaaaaaacg |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35795642 |
tttttaatctacttaaaaaacg |
35795621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University