View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15206_low_5 (Length: 459)
Name: NF15206_low_5
Description: NF15206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15206_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 2e-53; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 19 - 173
Target Start/End: Complemental strand, 40283561 - 40283407
Alignment:
| Q |
19 |
tcaaagtccccaacaactcatcaaggcatagcaaaccaggacaagactaagtatatgaggcaattaaatacaagaccacagcctttgtagcatcattcac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
40283561 |
tcaaagtccccaacaactcatcaaggcatagcaaaccaggacaagactaagtatatgaggcaattaaatacaagaccactgctcttgtagcatcattcac |
40283462 |
T |
|
| Q |
119 |
tcaccacaaaactaaacaagaatatgacatcaatcactttgccaaaaaaggagct |
173 |
Q |
| |
|
||| |||||||||| ||||| || |||| ||| |||| ||||||||||||||| |
|
|
| T |
40283461 |
tcatagcaaaactaaataagaaaatcacattaattacttcgccaaaaaaggagct |
40283407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 292 - 381
Target Start/End: Complemental strand, 40283351 - 40283263
Alignment:
| Q |
292 |
gtttcaacaaacatacaccaatgttattggttgctgccaaatgctaattctgcaaaacaaaatttagcagcaacatcccattaagtatac |
381 |
Q |
| |
|
||||||| ||| ||||||||||||| |||||||| || ||||| |||||||||||||| ||||||||||||||||| |||||| ||||| |
|
|
| T |
40283351 |
gtttcaagaaatatacaccaatgtttttggttgcagc-aaatgataattctgcaaaactgaatttagcagcaacatcacattaactatac |
40283263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 200 - 256
Target Start/End: Complemental strand, 40283406 - 40283350
Alignment:
| Q |
200 |
aacgattccctcttaacatttcagttctgcacctcaccatacaataggatcagcagt |
256 |
Q |
| |
|
|||||||||||||||| |||||| |||||| |||||||||||||| ||||||||| |
|
|
| T |
40283406 |
aacgattccctcttaatgcttcagtcctgcacttcaccatacaatagaatcagcagt |
40283350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University