View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15207_low_6 (Length: 280)
Name: NF15207_low_6
Description: NF15207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15207_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 104 - 201
Target Start/End: Complemental strand, 34317076 - 34316979
Alignment:
| Q |
104 |
tccctctaaactccaataaatcaacatccatcaaattagtgtttagggtttagagataacaaataagtgttcataatcttttagcatacacattctta |
201 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34317076 |
tccctctaaactccaacaaatcaacatccatcaaattagtgtttagggtttagagataacaaataagtgttcataatcttttagcatgcacattctta |
34316979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 34317179 - 34317131
Alignment:
| Q |
1 |
gttcactcaccactgacaattaatagtcgttacgtactggtcatatact |
49 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34317179 |
gttcactcaccggtgacaattaacagtcgttacgtactggtcatatact |
34317131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 246 - 280
Target Start/End: Complemental strand, 34316938 - 34316904
Alignment:
| Q |
246 |
tatattagtgtttagggtttagaatattgatgatt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34316938 |
tatattagtgtttagggtttagaatattgatgatt |
34316904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University