View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15207_low_7 (Length: 236)
Name: NF15207_low_7
Description: NF15207
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15207_low_7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 13 - 236
Target Start/End: Original strand, 34316549 - 34316773
Alignment:
| Q |
13 |
gaatatgcttttaatcctttggatatcttaaatttgcctactaatgactttcctaatttggatggtnnnnnnnnnn-ggaccgatgctattagggagttg |
111 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34316549 |
gaatatggttttaatcctttggatatcttaactttgcctactaatgactttcctaatttggatggtaaaaaaaaaaaggaccgatgctattagggagttg |
34316648 |
T |
|
| Q |
112 |
catgcaaaggtttgagccaacagtcagaagaagaatgaatggtatgcaaagcaagctaatatgaggattgaacattttccaaatcaaagaaaatccaaac |
211 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34316649 |
catgcaaaggttcgagccaacaatcagaagaagaatgaatagtatgcaaagcaagctaatatgaggattgaacattttccaaatcaaagaaaatccaaac |
34316748 |
T |
|
| Q |
212 |
tgaacccaagaggagatgaaccttt |
236 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
34316749 |
tgaacccaagaggagatgaaccttt |
34316773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 200 - 236
Target Start/End: Complemental strand, 16935218 - 16935182
Alignment:
| Q |
200 |
gaaaatccaaactgaacccaagaggagatgaaccttt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16935218 |
gaaaatccaaactgaacccaagaggagatggaccttt |
16935182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University