View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15208_high_4 (Length: 438)
Name: NF15208_high_4
Description: NF15208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15208_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 19474538 - 19474315
Alignment:
| Q |
1 |
aatgttgatgaaaaagttagggaagaagttgagaatctaactttgtttaaataatgtactttaggtttagatagagacatttattagaatctaaaataac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
19474538 |
aatgttgatgaaaaagttagggaagaagttgagaatctaactttgtttaaataatgtactttaggtttcgatagagacatttattagaatctaaaataac |
19474439 |
T |
|
| Q |
101 |
acgggtttggaacttaaataaattactttttgaaaaggtcaataatatagcagcttgtaattttaaactttatatttctccctctagaggaaaagagttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
19474438 |
acgggtttggaacttaaataaattactttttgaaaaggtcaataatatagcagcttgtaattttaaactttatatttccccgtctagaggaaaagagttg |
19474339 |
T |
|
| Q |
201 |
cacctagtactttgaattttaacc |
224 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
19474338 |
cacctagtattttgaattttaacc |
19474315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 145; E-Value: 4e-76
Query Start/End: Original strand, 250 - 430
Target Start/End: Complemental strand, 19474296 - 19474116
Alignment:
| Q |
250 |
tagatgttaaatgagtttaaatctcattccacttacctaaggattacaactttgcgacacgtctttggtaagctattggctttaccgacttatcgttctt |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19474296 |
tagatgttaaatgagtttaaatctcattccacttacctcataattgcaactttgcgacacgtctttggtaagctattggctttaccaacttatcgttctt |
19474197 |
T |
|
| Q |
350 |
tcaaggggattatctttatgtttggctgcatcgtggcattgatggtcattctagatttctgtttatgtccgcttgatgatg |
430 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19474196 |
tcaaggggatgatctttatgtttggctgcgtcgtggtattgatggtcattctagatttctgtttatgtccgcttgttgatg |
19474116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 355 - 418
Target Start/End: Original strand, 25785853 - 25785916
Alignment:
| Q |
355 |
gggattatctttatgtttggctgcatcgtggcattgatggtcattctagatttctgtttatgtc |
418 |
Q |
| |
|
||||| |||||||||||||||||| |||||| ||||||||| | ||||| ||| |||||||||| |
|
|
| T |
25785853 |
gggatgatctttatgtttggctgcgtcgtggtattgatggtaaatctagctttttgtttatgtc |
25785916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 61; Significance: 5e-26; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 300 - 419
Target Start/End: Original strand, 3941511 - 3941631
Alignment:
| Q |
300 |
tttgcgacacgtctttggtaagctattggctttaccgacttatcgttctttcaaggggattatctttatgtttggctgc-atcgtggcattgatggtcat |
398 |
Q |
| |
|
|||||||| |||| |||| || |||||||||||||||||||||| ||||| ||| || ||||||||||||||||||||| | |||| |||||||| ||| |
|
|
| T |
3941511 |
tttgcgactcgtccttggcaaactattggctttaccgacttatctttcttccaaaggaattatctttatgtttggctgcgtttgtggtattgatggccat |
3941610 |
T |
|
| Q |
399 |
tctagatttctgtttatgtcc |
419 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
3941611 |
tctagatttctttttatgtcc |
3941631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 345 - 424
Target Start/End: Complemental strand, 33172855 - 33172776
Alignment:
| Q |
345 |
ttctttcaaggggattatctttatgtttggctgcatcgtggcattgatggtcattctagatttctgtttatgtccgcttg |
424 |
Q |
| |
|
||||||||||||||| ||||||||||| |||| | ||||| |||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
33172855 |
ttctttcaaggggatgatctttatgttcggcttccgcgtggtattgatggccattttagatttctgtttatgtccgcttg |
33172776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University