View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15208_low_12 (Length: 208)

Name: NF15208_low_12
Description: NF15208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15208_low_12
NF15208_low_12
[»] chr2 (2 HSPs)
chr2 (1-99)||(33545830-33545928)
chr2 (172-204)||(33545725-33545757)


Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 33545928 - 33545830
Alignment:
1 aactcactactacttcccacgtgcacattagagtatatccacgatgtaattcatggaaatcgattttgagtacttgagtggatcttacatataagcatc 99  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33545928 aactcactactactttccacgtgcacattagagtatatccacgatgtaattcatggaaatcgattttgagtacttgagtggatcttacatataagcatc 33545830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 172 - 204
Target Start/End: Complemental strand, 33545757 - 33545725
Alignment:
172 cttactcgagaaaaaatgaattataaaaagtat 204  Q
    |||||||||||||||||||||||||||||||||    
33545757 cttactcgagaaaaaatgaattataaaaagtat 33545725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University