View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15208_low_12 (Length: 208)
Name: NF15208_low_12
Description: NF15208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15208_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 33545928 - 33545830
Alignment:
| Q |
1 |
aactcactactacttcccacgtgcacattagagtatatccacgatgtaattcatggaaatcgattttgagtacttgagtggatcttacatataagcatc |
99 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33545928 |
aactcactactactttccacgtgcacattagagtatatccacgatgtaattcatggaaatcgattttgagtacttgagtggatcttacatataagcatc |
33545830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 172 - 204
Target Start/End: Complemental strand, 33545757 - 33545725
Alignment:
| Q |
172 |
cttactcgagaaaaaatgaattataaaaagtat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33545757 |
cttactcgagaaaaaatgaattataaaaagtat |
33545725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University