View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15208_low_9 (Length: 332)
Name: NF15208_low_9
Description: NF15208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15208_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 106 - 318
Target Start/End: Original strand, 36982199 - 36982410
Alignment:
| Q |
106 |
atgggttaggacaggttgcaactttgacactaatggcaatggaaatgcctaactggtggttgtggaacaaacataaactgtacagtacctggaaatcctc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36982199 |
atgggttaggacaggttgcaactttgacactaatggcaatggaaatgcctaactggtggttgtggaacaaacataaactgtacagtacctggaaatcctc |
36982298 |
T |
|
| Q |
206 |
ctgcaacaatttccgattttacccttggtgaacctgatttttatgatgttagtcttgtagatggtttcaacttgcctatagcaataaaggctatcaaatg |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36982299 |
ctgcaacaatttccgattttacccttggtgaacctgatttttatgatgttagtcttgtagatggtttcaacttgcctatagcaataaaggctatc-aatg |
36982397 |
T |
|
| Q |
306 |
gaagtggtaattg |
318 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36982398 |
gaagtggtaattg |
36982410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 234 - 311
Target Start/End: Original strand, 36963123 - 36963200
Alignment:
| Q |
234 |
tgaacctgatttttatgatgttagtcttgtagatggtttcaacttgcctatagcaataaaggctatcaaatggaagtg |
311 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||| || |||||||||||| | ||||| ||||||||||| |
|
|
| T |
36963123 |
tgaacctgatttttatgatgttagtcttacagatggcttcaatttacctatagcaatagaagctattaaatggaagtg |
36963200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University