View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15209_high_3 (Length: 274)
Name: NF15209_high_3
Description: NF15209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15209_high_3 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 28615878 - 28615605
Alignment:
| Q |
1 |
tcactgcttgtatgattattgattggtttgtcatcgttgtaatgatgctcatgaatggtttgtccaaaattgatatatgtttgttgatttgtgttcaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28615878 |
tcactgcttgtatgattattgattggtttgtcatcgttgtaatgatgctcatgaatggtttgtccaaaattgatatatgtttgttgatttgtgttcaact |
28615779 |
T |
|
| Q |
101 |
ccatattgctatgcattctactactcttttcatgaatggttcgatgcttggtagcgaagggtttcacatctgccatgcttctactttttgatacatttct |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28615778 |
ccatattgctattcattctactactcttttcatgaatggttcgatgcttggtagctaagggtttcacatctgccatgcttttactttttgatacatttct |
28615679 |
T |
|
| Q |
201 |
tttgaaaattctactcaatgtccaaatttcctgcatatcatatagaaaaatcattagaacaagtttgagaggaa |
274 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28615678 |
tttgaaaattctacacaatgtccaaatttcctgcatgtcatatagaaaaatcattagaacaagtttgagaggaa |
28615605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 184 - 259
Target Start/End: Complemental strand, 28630049 - 28629974
Alignment:
| Q |
184 |
ctttttgatacatttcttttgaaaattctactcaatgtccaaatttcctgcatatcatatagaaaaatcattagaa |
259 |
Q |
| |
|
|||| ||||||||||||||| | |||||||| ||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
28630049 |
ctttgtgatacatttctttttagaattctacacaatgtccaaatttcctgcatgtcaaggagaaaaatcattagaa |
28629974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 67 - 108
Target Start/End: Complemental strand, 28630166 - 28630125
Alignment:
| Q |
67 |
aaattgatatatgtttgttgatttgtgttcaactccatattg |
108 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
28630166 |
aaattgatatatgtttgttgatttatgttgaactccatattg |
28630125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University