View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1520_high_12 (Length: 396)
Name: NF1520_high_12
Description: NF1520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1520_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 6 - 392
Target Start/End: Complemental strand, 18714054 - 18713671
Alignment:
| Q |
6 |
agtaaattatgtcatttctcctgtcttcaatataaaacatatgggtgatcgacgcatggtaaggtgaagattactaagtttcatatctgaattttcaaga |
105 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18714054 |
agtaaattatgtgatttctcctgtcttcaatataaaacatatgggtgatcgacgcatggtaaggtgaagattactaagtttcatatctgaattttcaaga |
18713955 |
T |
|
| Q |
106 |
atatggacggtttttgaatgcacaaagcaatttatggagaacaaatattgaacattcctaagttttttggagaagaatatgattttatttatatttttat |
205 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18713954 |
atatggacgatttttgaatgcacaaagcaatttatggagaacaaatattgaacattcctaagttttttggagaaggatatgattttatttatatttttat |
18713855 |
T |
|
| Q |
206 |
nnnnnnnnnnnnttagttattcaccatctttcaataacaattgatgttgttcattcatcctcttcattgatctaatcttcaaaaacaactcctctttctc |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18713854 |
---aaaaaaaaattagttattcaccatctttcaataacaattgatgttgttcattcatcctcttcattgatctaatcttcaaaaacaactcctctttctc |
18713758 |
T |
|
| Q |
306 |
aatttaactaaagggaattccttcaacttccaacttggttaccttagcctccaaggttgtcttctcatcggataaaccctctgccta |
392 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18713757 |
aatttaactaaagggaattccttcaacttccaacttggttaccttagcctccaaggttgtcttctcatcggataaaccctctgccta |
18713671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University