View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1520_high_22 (Length: 237)
Name: NF1520_high_22
Description: NF1520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1520_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 46921709 - 46921490
Alignment:
| Q |
1 |
ctgtttgttggttcttgagaaaagtagaaacaaaaccttgttcttcattttgaaggttgaaattggtgtagtcaaagtttgcttcagaatctgttaaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46921709 |
ctgtttgttggttcttgagaaaagtagaaacaaaaccttgttcttcattttgaaggttgaaattggtgtagtcaaagtttgcttcagaatctgttaaaag |
46921610 |
T |
 |
| Q |
101 |
gttgtaattgtagtggtctttgttgaatccataggtgaaagggtcttgtggatatagtagagttggttctagcgccatggatctctctctttctctattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46921609 |
gttgtaattgtagtggtctttgttgaatccataggtgaaagggtcttgtggatatagtagagttggttctagcgccatggatctctctctttctctattt |
46921510 |
T |
 |
| Q |
201 |
tcctctggtaaacacatgtg |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
46921509 |
tcctctggtaaacacatgtg |
46921490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University