View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1520_high_29 (Length: 219)
Name: NF1520_high_29
Description: NF1520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1520_high_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 11 - 203
Target Start/End: Complemental strand, 15890298 - 15890106
Alignment:
| Q |
11 |
attattcttatggtagctttctggaactgtttatattactcacactcaaatgttgggtggtgcactttcaactccaacaactcaatgcctcaaaacaaga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15890298 |
attattcttatggtagctttctggaactgttcatattactcacactcaaatgttgggtggtgcactttcaactccaacaactcaatgcctcaaaacaaga |
15890199 |
T |
|
| Q |
111 |
acaacaatagttacgatgctttatccatctcatagattattgtccacacatttttgtctctttaaggtaccacttctcttcatccatgttcct |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15890198 |
acaacaatagttacgatgctttatccatctcatagattattgtccacacatttttgtctctttaaggtaccacttctcttcatccatgttcct |
15890106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University