View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1520_low_21 (Length: 270)
Name: NF1520_low_21
Description: NF1520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1520_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 32 - 256
Target Start/End: Original strand, 24676848 - 24677072
Alignment:
| Q |
32 |
ctctttgccctaaaagtcgttgacaaaacctccatccacgccaaacttgacgccgaacgccgcgcccgatgggaaatccaagtcctctccaccctctccc |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24676848 |
ctctttgccctaaaagtcgttgacaaaacctccatccacgccaaacttgacgccgaacgccgcgcccgatgggaaatccaagtcctctccaccctctccc |
24676947 |
T |
 |
| Q |
132 |
accctttcctcccttcaatccttggtacatatgaatccccacagtttcttgcatgggccctaccttattgtcccggtggtgacctcaatgttctccgtta |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24676948 |
accctttcctcccttcaatccttggtacatatgaatccccacagtttcttgcatgggccctgccttattgtcccggtggtgacctcaatgtcctccgtta |
24677047 |
T |
 |
| Q |
232 |
ccgtcaaaacgaccgtgttttctct |
256 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
24677048 |
ccgtcaaaacgaccgtgttttctct |
24677072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University