View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1520_low_25 (Length: 235)
Name: NF1520_low_25
Description: NF1520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1520_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 225
Target Start/End: Complemental strand, 50370011 - 50369803
Alignment:
| Q |
17 |
aatggacgtagaagaacaacagaaagaggaagaagatccttttctcaatttcgtcgatcaagcaagatccgagctattgtcgctagaagacgattcaaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50370011 |
aatggacgtagaagaacaacagaaagaggaagaagatccttttctcaatttcgtcgatcaagcaagatccgagctattgtcgctagaagacgattcaaat |
50369912 |
T |
 |
| Q |
117 |
cgtggtgattcggatacatctggttatggttggagttggattgtatctcgtattcttaaaacttgcattgcgtattcgagcggcgttactcctgcgattt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
50369911 |
cgtggtgattcggatacatctggttatggttggagttggattgtatctcgtattcttaaaacttgtattgcgtattcgagcggcgttactcctgcgattt |
50369812 |
T |
 |
| Q |
217 |
tgctctctg |
225 |
Q |
| |
|
||||||||| |
|
|
| T |
50369811 |
tgctctctg |
50369803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University