View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1520_low_32 (Length: 216)
Name: NF1520_low_32
Description: NF1520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1520_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 2629783 - 2629580
Alignment:
| Q |
1 |
actcatagacaagattgaaacaagaaagnnnnnnngaacaatggttcgaaaaggtgatattgtttgggtaagagaaatttacttccctcacaacaacaac |
100 |
Q |
| |
|
||||||| |||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
2629783 |
actcataaacaagattgaaacaagaaagaaaaaaagaagaatggttcgaaaaggtgatattgtttgggtaagagaaattcagttccctcacaacaacaac |
2629684 |
T |
 |
| Q |
101 |
---tacaattggtctccagctttagttaaatcttccaacaacctcggcatctcactttccttcttcaacaaccccaaccccacacaacgcaccttctttc |
197 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2629683 |
aactacaattggtctccagctttagttacatcttccaaccacctcggcatctcactttccttcttcaacaaccccaacaccacacaacgcaccttctttc |
2629584 |
T |
 |
| Q |
198 |
ttca |
201 |
Q |
| |
|
|||| |
|
|
| T |
2629583 |
ttca |
2629580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University