View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15212_low_12 (Length: 216)
Name: NF15212_low_12
Description: NF15212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15212_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 51334271 - 51334471
Alignment:
| Q |
1 |
agaaattggaagtggggttggtttcaagaggaggagaatcattagagttggtaggaggagattcttcgaaagtggggtcctcaatggcaacaccctcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
51334271 |
agaaattggaagtggggttggtttcaagaggaggagaatcattagagttggtaggaggagattcttcgaaagtggggtcctcaatggcaacatcctcatt |
51334370 |
T |
 |
| Q |
101 |
agagaaatcaaagagatcttcaacaatgaagtggtcggaagcagcagtgtttacattgtttgtgttcgaattgttgttggattggaaaaactcttgagct |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51334371 |
agagaaatcaaagagatcttcaacgatgaagtggtcggaagcagcagtgtttacattgtttgtgttcgaattgttgtcggattggaaaaactcttgagct |
51334470 |
T |
 |
| Q |
201 |
t |
201 |
Q |
| |
|
| |
|
|
| T |
51334471 |
t |
51334471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University