View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15212_low_4 (Length: 411)
Name: NF15212_low_4
Description: NF15212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15212_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 7e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 152 - 267
Target Start/End: Original strand, 3752464 - 3752579
Alignment:
| Q |
152 |
tggtcctctcaaaatgagcccaaattttatgacatgtctttaaaaaatgtgttaacaaagcttcgacacaaaaaggtaagaaagctggtgtgaaaagaaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3752464 |
tggtcctctcaaaatgagcccaaattttatgacatgtctttaaaaaatgtgttaacaaagcttcgacacaaaaaggtaagaaagctggtgtgaaaagaaa |
3752563 |
T |
|
| Q |
252 |
ttaatacaaaacattg |
267 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3752564 |
ttaatacaaaacattg |
3752579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 324 - 399
Target Start/End: Original strand, 3752633 - 3752709
Alignment:
| Q |
324 |
gacttgaatattcagagtatacttttaattagtgtttgcagt-nnnnnnntagtgttatgaatgatttttcaatatt |
399 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3752633 |
gactcgaatattcagagtatacttttaattagtgtttgcagtaaaaaaaatagtgttatgaatgatttttcaatatt |
3752709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University